|
Biotechnology Information
ncbi nucleotide basic localized alignment search tool nblast Ncbi Nucleotide Basic Localized Alignment Search Tool Nblast, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/bio_rxiv__64898__2026__01__09__698610-64-26-24?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
ncbi nucleotide basic localized alignment search tool nblast - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Biotechnology Information
ncbi nucleotide database Ncbi Nucleotide Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/10__1016_slash_j__foreco__2018__06__017-80-13-11?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
ncbi nucleotide database - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Biotechnology Information
ncbi 2025a core nucleotide blast database Ncbi 2025a Core Nucleotide Blast Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pm41770492-163-22-20?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
ncbi 2025a core nucleotide blast database - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Biotechnology Information
ribosomal rna sequence database Ribosomal Rna Sequence Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pmc12335041-192-3-15?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
ribosomal rna sequence database - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Biotechnology Information
ncbi open reading frame orf finder tool Ncbi Open Reading Frame Orf Finder Tool, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pm25112314-57-12-10?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
ncbi open reading frame orf finder tool - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Biotechnology Information
biotechnology information ncbi genbank Biotechnology Information Ncbi Genbank, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/10__1016_slash_j__temicr__2025__100014-100-18-18?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
biotechnology information ncbi genbank - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Addgene inc
lmpd hmdr1 ametrine ![]() Lmpd Hmdr1 Ametrine, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pmc05741099-744-125-122?v=Addgene+inc Average 93 stars, based on 1 article reviews
lmpd hmdr1 ametrine - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Biotechnology Information
ncbi nucleotide blast ![]() Ncbi Nucleotide Blast, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pm42104494-58-4-10?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
ncbi nucleotide blast - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Biotechnology Information
ncbi nucleotide blast tool 37 ![]() Ncbi Nucleotide Blast Tool 37, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pmc13051378-75-21-12?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
ncbi nucleotide blast tool 37 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Biotechnology Information
nucleotide blast blastn suite ![]() Nucleotide Blast Blastn Suite, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/10__3390_slash_horticulturae12010111-82-24-16?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
nucleotide blast blastn suite - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
SourceForge net
mira assembler ![]() Mira Assembler, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/10__1128_slash_jcm__00466___19-360-34-33?v=SourceForge+net Average 90 stars, based on 1 article reviews
mira assembler - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Biotechnology Information
local alignment search tool nucleotide blastn national center for biotechnology information ![]() Local Alignment Search Tool Nucleotide Blastn National Center For Biotechnology Information, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pmc12745028-125-20-28?v=Biotechnology+Information Average 86 stars, based on 1 article reviews
local alignment search tool nucleotide blastn national center for biotechnology information - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Immunity
Article Title: The xenobiotic transporter Mdr1 enforces T cell homeostasis in the presence of intestinal bile acids
doi: 10.1016/j.immuni.2017.11.012
Figure Lengend Snippet:
Article Snippet: Rag1 −/− Slc10a2 −/− This paper N/A Oligonucleotides Abcb1a ametrine 5′ CRISPR gRNA: 5′-GCUUCUCAAUGGUCAGUGUGCUGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU-3′ PNA Bio Inc. N/A ametrine Abcb1a 3′ CRISPR gRNA: 5′-GAAAAUACUUAACAUCUUACAUGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU-3′ PNA Bio Inc. N/A Universal 16S rDNA Forward: 5′-ACTCCTACGGGAGGCAGCAGT-3′ Integrated DNA Technologies Ayres et al., 2012 Universal 16S rDNA Reverse: 5′-ATTACCGCGGCTGCTGGC-3′ Integrated DNA Technologies Ayres et al., 2012 Abcb1a ametrine 5′ Genotype Primer: 5′-AGTTTAACGTGTCTGCAGCTGG-3′ Integrated DNA Technologies N/A Abcb1a ametrine 3′ Genotype Primer: 5′-AGCCTGCAGGATCTGTCTG-3′ Integrated DNA Technologies N/A Recombinant DNA Plasmid: LMPd-ametrine Chen et al., 2014 Dr. Matthew Pipkin Plasmid: LMPd-GFP This paper N/A Plasmid: pSTBlue-1 Novagen Cat# 70199 shRNAmir: Cd8a TransOMIC Technologies Cat# TLMSU1400-12525 shRNAmir: Abcb1a TransOMIC Technologies Cat# TLMSU1400-18671 shRNAmir: Abcb1b TransOMIC Technologies Cat# TLMSU1400-18669 pHaMDRwt Pastan et al., 1988
Techniques: Blocking Assay, Purification, Recombinant, Staining, Gene Expression, Magnetic Beads, Cell Isolation, SYBR Green Assay, Mutagenesis, Detection Assay, Fluorescence, Generated, CRISPR, Plasmid Preparation, Sequencing, Software