ncbi nucleotide basic local alignment search tool blast program Search Results


86
Biotechnology Information ncbi nucleotide basic localized alignment search tool nblast
Ncbi Nucleotide Basic Localized Alignment Search Tool Nblast, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/bio_rxiv__64898__2026__01__09__698610-64-26-24?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
ncbi nucleotide basic localized alignment search tool nblast - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Biotechnology Information ncbi nucleotide database
Ncbi Nucleotide Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/10__1016_slash_j__foreco__2018__06__017-80-13-11?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
ncbi nucleotide database - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Biotechnology Information ncbi 2025a core nucleotide blast database
Ncbi 2025a Core Nucleotide Blast Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pm41770492-163-22-20?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
ncbi 2025a core nucleotide blast database - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Biotechnology Information ribosomal rna sequence database
Ribosomal Rna Sequence Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pmc12335041-192-3-15?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
ribosomal rna sequence database - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Biotechnology Information ncbi open reading frame orf finder tool
Ncbi Open Reading Frame Orf Finder Tool, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pm25112314-57-12-10?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
ncbi open reading frame orf finder tool - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Biotechnology Information biotechnology information ncbi genbank
Biotechnology Information Ncbi Genbank, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/10__1016_slash_j__temicr__2025__100014-100-18-18?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
biotechnology information ncbi genbank - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

93
Addgene inc lmpd hmdr1 ametrine

Lmpd Hmdr1 Ametrine, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pmc05741099-744-125-122?v=Addgene+inc
Average 93 stars, based on 1 article reviews
lmpd hmdr1 ametrine - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

86
Biotechnology Information ncbi nucleotide blast

Ncbi Nucleotide Blast, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pm42104494-58-4-10?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
ncbi nucleotide blast - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Biotechnology Information ncbi nucleotide blast tool 37

Ncbi Nucleotide Blast Tool 37, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pmc13051378-75-21-12?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
ncbi nucleotide blast tool 37 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Biotechnology Information nucleotide blast blastn suite

Nucleotide Blast Blastn Suite, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/10__3390_slash_horticulturae12010111-82-24-16?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
nucleotide blast blastn suite - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
SourceForge net mira assembler

Mira Assembler, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/10__1128_slash_jcm__00466___19-360-34-33?v=SourceForge+net
Average 90 stars, based on 1 article reviews
mira assembler - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
Biotechnology Information local alignment search tool nucleotide blastn national center for biotechnology information

Local Alignment Search Tool Nucleotide Blastn National Center For Biotechnology Information, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+nucleotide+basic+local+alignment+search+tool+blast+program/pmc12745028-125-20-28?v=Biotechnology+Information
Average 86 stars, based on 1 article reviews
local alignment search tool nucleotide blastn national center for biotechnology information - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results


Journal: Immunity

Article Title: The xenobiotic transporter Mdr1 enforces T cell homeostasis in the presence of intestinal bile acids

doi: 10.1016/j.immuni.2017.11.012

Figure Lengend Snippet:

Article Snippet: Rag1 −/− Slc10a2 −/− This paper N/A Oligonucleotides Abcb1a ametrine 5′ CRISPR gRNA: 5′-GCUUCUCAAUGGUCAGUGUGCUGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU-3′ PNA Bio Inc. N/A ametrine Abcb1a 3′ CRISPR gRNA: 5′-GAAAAUACUUAACAUCUUACAUGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU-3′ PNA Bio Inc. N/A Universal 16S rDNA Forward: 5′-ACTCCTACGGGAGGCAGCAGT-3′ Integrated DNA Technologies Ayres et al., 2012 Universal 16S rDNA Reverse: 5′-ATTACCGCGGCTGCTGGC-3′ Integrated DNA Technologies Ayres et al., 2012 Abcb1a ametrine 5′ Genotype Primer: 5′-AGTTTAACGTGTCTGCAGCTGG-3′ Integrated DNA Technologies N/A Abcb1a ametrine 3′ Genotype Primer: 5′-AGCCTGCAGGATCTGTCTG-3′ Integrated DNA Technologies N/A Recombinant DNA Plasmid: LMPd-ametrine Chen et al., 2014 Dr. Matthew Pipkin Plasmid: LMPd-GFP This paper N/A Plasmid: pSTBlue-1 Novagen Cat# 70199 shRNAmir: Cd8a TransOMIC Technologies Cat# TLMSU1400-12525 shRNAmir: Abcb1a TransOMIC Technologies Cat# TLMSU1400-18671 shRNAmir: Abcb1b TransOMIC Technologies Cat# TLMSU1400-18669 pHaMDRwt Pastan et al., 1988 Addgene Plasmid #10957 LMPd.hMDR1-ametrine (containing wild-type human MDR1) (NCBI reference sequence {"type":"entrez-nucleotide","attrs":{"text":"NM_001348945.1","term_id":"1149123046"}} NM_001348945.1 ) This paper N/A LMPd. hMDR1-ametrine (containing transport-deficient human MDR1; Y401A, Y1044A) α This paper Kim et al., 2006 Software and Algorithms Graphpad Prism 7 GraphPad Software http://www.graphpad.com FlowJo (Version 9.9.4) TreeStar, Inc. http://www.flowjo.com GenePattern (Version 3.9.10) Broad Institute https://genepattern.broadinstitute.org nSolver Analysis Software (Version 1.1) Nanostring https://www.nanostring.com Other NanoString nCounter Sundrud_03 chip This paper https://www.nanostring.com NanoString nCounter Sundrud_04 chip This paper https://www.nanostring.com Open in a separate window

Techniques: Blocking Assay, Purification, Recombinant, Staining, Gene Expression, Magnetic Beads, Cell Isolation, SYBR Green Assay, Mutagenesis, Detection Assay, Fluorescence, Generated, CRISPR, Plasmid Preparation, Sequencing, Software